34 Hidden Advantages of Exercising

 

Elliott Hulse on The Benefits of Working Out

Video taken from the channel: London Real


 

Attractive Face or Not? It depends on Tongue Posture

Video taken from the channel: What I’ve Learned


 

How To Boost Testosterone Naturally For Men (8 WAYS I DOUBLED MINE) | LiveLeanTV

Video taken from the channel: Live Lean TV


 

The Benefits of Working Out

Video taken from the channel: ThePostGame


 

Many Benefits of Exercise: Mayo Clinic Radio

Video taken from the channel: Mayo Clinic


 

Top 10 Benefits of Exercise | Health Benefits of Exercise

Video taken from the channel: Doctor Mike Hansen


 

How Does COVID-19 Testing Actually Work?

Video taken from the channel: The Thought Emporium


The benefits of working out go far beyond the calorie burn! Discover the many hidden benefits of working out, including increased metabolism, reduced cancer risk, and improved mood. Some start within the very first minute of exercising!As well as many obvious benefits to working out, there are also a lot of hidden benefits, so prepare yourself, as we take you through our list of 31 hidden benefits! #1) People respect you more – seems strange, but people seem to subconsciously award more respect to someone that is in shape. #2) It teaches discipline. #3) Improved health.

Working out has many health benefits that will make your life better. The first thing many people want to ultimately achieve in life is happiness. A study that was conducted at Penn State University concluded that people on average who worked out. The Hidden Benefits of Doing Work You Really Don’t Want To Do.

What Came Out In The Wash. The single biggest problem in communication is the illusion that it has taken place. 11 Reasons You Should Start Working Out Today 1. Boost happiness levels.

Whether we’re fully conscious of it or not, we’re always looking for how to be happy.And exercise is one of the most obvious steps to take, as it’s not a coincidence that you feel better after a good workout: It’s science. Being active has been shown to have many health benefits, both physically and mentally. It may even help you live longer ( 1 ). Here are the top 10 ways regular exercise benefits your body and brain. Working out regularly brings the following benefits: 1. Slower heart rate.

If you work out regularly, your heart is pumping more efficiently. That means your heart simply does not need to pump as many times per minute, for example, that it used to. You do the same amount of work with less effort. So if your resting heart rate was 80 beats a. The idea of having to work a 10 hour work-day, 5 days a week, for 40-50 years, doing something that I don’t like doing, and spending 2 hours of that time in traffic every day made me want to VOMIT.

That is why even though I didn’t have a lot of time on my hands, I started my first business 20 years ago and worked on it whenever I could. The Hidden Benefits of Hard Work. by Mr. 4HWD on November 11, If you’re looking for a competitive edge and a way to stand out and get noticed, hard work is the answer.

Those who have achieved success often attribute their success to hard work, determination, and perseverance. Michael Jordan is a great example of someone who used work. Working out while you’re actually at work, not only has huge benefits for productivity, collaboration, and mood, but is also dead simple to implement.

More from Entrepreneur.

List of related literature:

Exercise burns fat and calories, improves circulation, regulates crapping, defines muscles, builds strength, and detoxifies your body through sweating.[18] Plus, working out helps keep junk food cravings and savage appetites at bay.

“Skinny Bastard: A Kick-in-the-Ass for Real Men Who Want to Stop Being Fat and Start Getting Buff” by Rory Freedman, Kim Barnouin
from Skinny Bastard: A Kick-in-the-Ass for Real Men Who Want to Stop Being Fat and Start Getting Buff
by Rory Freedman, Kim Barnouin
ReadHowYouWant.com, Limited, 2010

Benefits:: This exercise is good for postural control, and it involves the trunk musculature, shoulders and triceps.

“Respiratory Muscle Training E-Book: Theory and Practice” by Alison McConnell
from Respiratory Muscle Training E-Book: Theory and Practice
by Alison McConnell
Elsevier Health Sciences, 2013

According to the Mayo Clinic, there are seven benefits to regular exercise.

“Visualizing Human Biology” by Kathleen A. Ireland
from Visualizing Human Biology
by Kathleen A. Ireland
Wiley, 2017

Being able to do a pull-up or being able to “RX” a workout.

“Inside the Box: How CrossFit ® Shredded the Rules, Stripped Down the Gym, and Rebuilt My Body” by T. J. Murphy
from Inside the Box: How CrossFit ® Shredded the Rules, Stripped Down the Gym, and Rebuilt My Body
by T. J. Murphy
VeloPress, 2012

Getting in shape helps you become more alert and produces endorphins that cause you to have a sense of well-being.

“The Power of Your Words: How God Can Bless Your Life Through the Words You Speak” by Robert Morris
from The Power of Your Words: How God Can Bless Your Life Through the Words You Speak
by Robert Morris
Gospel Light, 2009

Exercise and improved insulin sensitivity in older women: Evidence of the enduring benefits of higher intensity training.

“Handbook of Obesity, Two-Volume Set” by George A. Bray, Claude Bouchard
from Handbook of Obesity, Two-Volume Set
by George A. Bray, Claude Bouchard
CRC Press, 2019

This helps you access all the deep abdominal muscles that give you the foundation for your core and nice muscle tone.

“What's Age Got to Do with It?: Living Your Healthiest and Happiest Life” by Robin McGraw
from What’s Age Got to Do with It?: Living Your Healthiest and Happiest Life
by Robin McGraw
Thomas Nelson, 2010

This exercise is useful if you have a low back injury.

“Natural Bodybuilding” by John Hansen
from Natural Bodybuilding
by John Hansen
Human Kinetics, 2005

Many studies show that exercise does everything from decreasing your risk of dementia to building good-looking muscle, so there are plenty of benefits to exercise.

“Lies My Doctor Told Me Second Edition: Medical Myths That Can Harm Your Health” by Ken Berry, Gary Fettke
from Lies My Doctor Told Me Second Edition: Medical Myths That Can Harm Your Health
by Ken Berry, Gary Fettke
Victory Belt Publishing, 2019

I’d been so absorbed with learning these new exercises that one of the biggest benefits had caught me completely by surprise.

“The New Rules of Lifting: Six Basic Moves for Maximum Muscle” by Lou Schuler, Alwyn Cosgrove
from The New Rules of Lifting: Six Basic Moves for Maximum Muscle
by Lou Schuler, Alwyn Cosgrove
Penguin Publishing Group, 2005

Alexia Lewis RD

Registered Dietitian Nutritionist and Certified Heath Coach who believes life is better with science, humor, and beautiful, delicious, healthy food.

[email protected]

View all posts

112 comments

Your email address will not be published. Required fields are marked *

  • Right after this video went up, one of my awesome friends Sebastian designed new primers which are much much better than the CDC or other primers used in this video. Here are their sequences for those interested and if you’d like, check out Sebastian’s work here: http://binomicalabs.org/
    SpikeF AGGAATTTTTATGAACCACAAATCA
    MembraneR CGGTGATCCAATTTATTCTGTAAAC
    NucleoF AAATGAAAGATCTCAGTCCAAGATG
    NucleoR ACAGTTTGCTGTTTCTTCTGTCTCT

  • I’ve exercised by jogging for the last 25 years and I now have non-reversible arthritis in my knees and can’t walk or jog more than about 5 blocks w/o quite alot of pain. Some days are better than others. My cardio these days can easily take me 20 kms plus, but the knees won’t let me. Did 20 kms last year and couldn’t walk by the end. This year I went to the doctor and he said there is no cure, prescribed some cream, a physiotherapist that may help in slowing down the severity of the arthritis, and a check up in 3 months. I can jog uphill w/o much problem, but the walk or careful jog back down is most always tough and pain enduring. Feeling good about what exercise is doing for my cardio, but facing possible cortisone shots, which only work temporarily, or possibly getting knee replacements were not in mind so much when starting to jog. Miss being able to jog and walk w/o pain. I’m 55.

  • This is a really detailed and amazing video! This information is important for the public to know, and I’m glad you’re putting it out there. I hope my videos become as well-explained as yours one day haha:D

  • Even though masks are required where I live, you still see people not wearing one, or only covering their mouth or their nose (they’re not even enforcing it), and even some employees are only halfway covering their faces. They should not allow people in buildings if they don’t have a mask, or not wear one properly, or ask them to leave the building.

  • quick stat correction: you stated that there are 22.3 million cases however this includes, dead, active cases, and people who have completely recovered. the correct stat for the people who currently infected is about 6.65 million.

  • The main content of the video is of course super awesome, but your introductory jabs to tinfoil hats and antivaxxers, and the harsh truthbomba at the end were just magnifique.

  • possibly dumb comment but lamp could come from L from loop and AMP from amplification, totally disregarding the mediated isothermal parts

  • Great video, one of your best and one of the more detailed analysis on covid19 I’ve ever seen. Only thing is, imho, the tone in the summary section got a bit preachy and I feel like it diminishes the seriousness of the rest of the video, irregardless of the fact that one may or may not agree. Great job nonetheless.

  • The world is overcrowded. I don’t think it is all bad when these ignorant people having lower chances of passing their stupid gene. Especially when it is by their own choice.

  • You don’t have to use expensive target specific fluorescent probes for qPCR. You can use normal PCR primers, Taq polymerase, and a dsDNA binding fluorescent dye, as long as you’re fine with non-specific detection. It’s limited to one reaction per well, and it’s sensitive to contamination, but it definitely works.

  • Could you do a video on the types of vaccines that are being researched and the process that goes into making them? Also the stages of testing that must go into a vaccine to ensure its safety and effectiveness? I think it would be really informative and I haven’t found any videos going very in depth about the process. Also if you had any suggestions for channels that talk about it I think many of us would appreciate the info!

  • Kind of hard to consider yourselves a civilized nation when you cant even adapt and deal with a mild crisis like this without destabilizing.

  • WOOOW congrats for the vid and thanks for the information! It would be cool a video about masks and their effectiveness. Keep on the great work and I’m hoping all of your loved ones are good.

  • Really Interesting video.
    Especially the fact that eating soft food and breathing through your mouth is connected to deformed teeth formations.

  • 7:13 That’s how you get anti-maskers and “influencers” and young morons to wear masks and socially-distance; just tell them how Covid-19 can mess up their junk. ��

  • Thank you for the informal video! I just posted a fitness video where my guest discusses how fitness influences her mental health. Would love if you could check it out! Thanks!

  • Almost nobody has any idea if they’re infected. Even if the have all the symptoms. You also can’t correlate symptoms with how contagious you might be. You either quit your job because you don’t really need to work, or you wait to see whether your going to have a medical emergency in the middle of your shift and keep your mouth shut to then. Keeping your mouth shut is also how you avoid spreading the virus.

  • My parents got the antibody test n my dad was positive so he got a pcr, came positive, i had a slight flu, came positive, my cousins entire fam except their dad n one bro got positive (including a 5 month old) but we’re good now so

  • it is INSANE how far you have come from the first videos I saw (the radio telescope/”wifi camera” adventures). the quality of science, recording, narrating, and overall production has jumped vastly; the scale and capability of your lap and tools have expanded as well; and perhaps most importantly, your passion for science and earnest pursuit of spreading knowledge has never yielded.

    Keep up the good work, keep yourself safe, and don’t forget to take breaks sometimes so you don’t burn yourself out!

  • You know what is the best natural way to increase testosterone? That is Tongkat Ali, and wildly grown Tongkat Ali! According to studies ( https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3669033/) tongkat ali have been increasing testosterone levels even 37% approximately! I am now having this tongkat ali for 1 month already and it have made so big change in my life that I wanna share that with everyone, because that really works! Here in Indonesia is one local project called Borneo Energy which sources only wild grown Tongkat Ali, not the farmed one, and without killing those trees while harvesting it. It is more than recommendable! Website can be found from borneo.energy

  • at the of the day it still in the genes they have the advantages the other one is still handsome while the other one is more attractive

  • I’ve been chewing gum before school testing for almost a decade now. No wonder my jawline is so nice. Massive confidence boost, thanks YouTube

  • I used to watch your videos all the time before I got busy with my new job as a COVID tester. As usual, it was an excellent video! Thank you for spreading such informative and educational content!

  • What a hell of an in-depth video about COVID-19 and how the tests work. And thank you for pointing out the simple things like wearing a mask and getting tested if you even SUSPECT you’ve been exposed. I’d be a patreon if I could, but can’t afford to yet.

  • at about 31:00 you state that people with past infections don’t PCR test positive actually, a surprising amount of people test positive weeks after a passed infection, due to “genetic garbage” still hanging around. These patients are, according to WHO standards, not considered infectious patients anymore.
    Do you know what this “genetic garbage” actually is? How long can naked pieces of RNA just hang out on mucous membranes?

  • Well i like to say i was 16 when i watched this im 17 now and really have notice facial changes but not just the tonge posture it’s about actaul spine posture and working out in a correct form this means running correctly to its about you being very aware and adjusting your body so it feels right and breathing from your nose while doing tongue posture (keeping it on the roof) also fix tight muscles because tight muscles can pull on you and affect your posture so you stand really werid at times and do fasting to because fasting releases HGH

  • As always, fantastic video. Thank you for the thoroughness. One potential aspect that would have been great to also cover would be “getting it twice”. I’ve seen a number of articles that show individuals who got positive, then negative, then positive tests seeming to show that they got reinfected. Said articles don’t back this idea up much, so it would be cool to hear what research you know about on this topic. To me, it seems that the first test that individuals took might have been a false positive. At 30:05 you said that false negatives are much worse. It seems that false positives can lead vulnerable people outside, as they think they already got over it. It can also lead the general population to believe that there are less vulnerable people left, and aim to minimize the apparent threat.
    I had heard reports that in Feb some US tests had 50% false positivity rates (but I don’t have the source readily available, so take it as you will). Surely, metrics have improved; though, I haven’t heard much on this topic in quite some time.

  • Very informative. I wasn’t aware of the LAMP testing but it’s very interesting. This video explains why testing is slow in some countries.

  • Thanks you for a clear explanation. Follow up question; Anti body testing is only useful for a short of time after recovery? Can you ball park how long that is? Would making the tests more sensitive extend that window to a point where the testing is useful for tracking a-symptomatic recoveries? PS: I’m not in the biology field (comp sci) so please excuse my ignorance.

  • You’re doing great work moderating these comments! The video is amazing and I’m sure I’ll sending it to many people to explain the situation.

  • Great video but I kind of laughed at the end. Putting a “listen to the scientist” spiel at the end of a 40 minute technical video on covid testing is the definition of preaching to the choir.

  • 1:55 THANK YOU!!!
    Finally someone with common fucking sense

    Even my brother did fall for some of those less extreme conspiracies and im the one at home that has to fight the good fight with evidence against this kind of bullshit.

  • did something happen to youtubes auto-generated closed captions? I rely a bit on captions (even though script based ones that youtube lets creators use as well are better) due to having bad hearing and it making it easier for me to watch videos and I just saw that it’s not an option on this video:(

  • Good rule of thumb is to only buy raw natural foods, meaning they were killed or picked then you eat them, in other words, nothing processed, no fillers, only basic ingredients w nothing added to them. Example, buy the peanut butter brand containing only peanuts and salt. It also helps to understand what foods are composed of them you just keep track in your head of sensible anoint you’ve eaten. Eating a whole pizza for example is all cheese and bread, you’re going to want to hold off on extra cheese and bread for a few days after bc your body just intook an unbalanced meal. It’s all about balancing your diet with the basics. Know that there is really no need at all for Food Scientists, they’re the ones responsible for everything unhealthy and really just love twiddeling away in their little lab like a mad scientist and are happy to take home a paycheck, given by some businessman who only, literally, cares about money, and that’s all. Just rely on farmers and you’ll be good.

  • This presentation was a bit overwhelming could have been broken into 10 minute lots from a YouTube profitability standpoint.>>> more strategic.>>>fried my brain after about 15 minutes

  • 39:12 I was almost as impressed by the fact that the auto-subtitles transcribed “Cheeto von Gropensnatcher” correctly as by the quality of the video ^^

  • I wear a plague doctor mask and outfit because modern “microbiology” lacks the remarkable simplicity of understanding the equilibrium of the humors or defines the rotation of flu with the seasons and the humors relation to the natural elements. It’s quite humorous.

  • “If you think this is bad ooohh weee are you in for a surprise as climate change ramps up”.
    I know this vid is about the coronavirus but i think more people need to realise this. Climate change cannot be compared with little things such as a pandemic, a complete collapse of the economy and growing inequality. Everyone agrees that 2020 is going to be remembered as one of the most sucky years of modern history. What we need to understand as a species is that climate change is going to make it so that every year is like 2020 all the time but then it is going to keep getting worse. We are not killing the planet. We are just destroying the intricate balance on which our way of life is based.

  • “RT” in “RT-PCR” stands for Reverse Transcription (or Transcriptase), not Real-Time. qPCR is quantitative PCR (real-time), and “Real Time RT-PCR”, or “rRT-PCR” or even “RT-qPCR” is real-time RT-PCR. ��

  • Ancient greeks also connected ming and body together-kalokaghathia not only eastjust monotheistic religions miss this idea-Judaism, christianity and Islam

  • Doc, does deep breathing exercises (inhale to count of 4, hold for count of 4, exhale aggressively count of 7), such as “swimmer’s breath,” help mitigate against pneumonia later such as with Covid-19?

  • i am 63 years old and I have been lifting a 48kg barbell for 10 years now. I enjoy perfect health. Yes, weight lifting is indeed a panacea.

  • If you don’t have the motivation to exercise then you will have the motivation for chemotherapy. Because obesity ultimately leads to cancer, especially in women. The cancer will take the pounds of of you fast. That’s how it happened in my family.

  • Most interesting part for me was when you were talking about building your own mask and I saw you guitar in the background! What do you like to play??

  • Part of the problem of obesity is there is no sidewalks! Either you drive ride a bike hopping you won’t get run over or walk on dirt/grass.

  • Actually kind of blown away that you just exploit the RNAs goal to self replicate but do it in a lab and look for the result that it’s duplicated exponentially ��

  • We need to stop hiding this and start talking about it. So please do me a favor and share this video with your homies, your bro, your husband, and all the other dudes in your life.
    ✔ Take the Live Lean Body Quiz: http://bit.ly/2BAsWJ7

  • Flaxseed is the biggest source of xeno estrogen, even worse than soy. Your recommending really makes everything else you’re saying questionable.

  • Do natural popular male enhancement like Penlargerem System really work and if so, how effective are they? I’ve heard many amazing things about this popular male enhancement.

  • I thought it was weird when I rarely took pictures and realized my jawlines somehow changed… so it changes often depending how its being influenced?

  • what is the standard amount of time it takes for PCR to complete? my roommate has had flu like symptoms so we are both staying home but his test came back negative after 2 days. mine took 7 days (negative). i think they mixed his up with someone else.

  • You know what is the best natural way to increase testosterone? That is Tongkat Ali, and wildly grown Tongkat Ali! According to studies ( https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3669033/) tongkat ali have been increasing testosterone levels even 37% approximately! I am now having this tongkat ali for 1 month already and it have made so big change in my life that I wanna share that with everyone, because that really works! Here in Indonesia is one local project called Borneo Energy which sources only wild grown Tongkat Ali, not the farmed one, and without killing those trees while harvesting it. It is more than recommendable! Website can be found from borneo.energy

  • I do this since kid cuz logopeda told me it was the correct position of the tongue. But, because my tongue is really strong and I have small teeth and lips, now my teeth have a gap due to this

  • I’m 26. My test levels were 675ng/dl

    After I had my blood tested I..

    did have low d3, so I bought a supplement for that. Just a standard walmart one, not sure of their efficacy. 10000iu per day.

    I have been eating one cup of raisins for the boron content per day.

    3 Garlic cloves a day.

    I do two to three full body weight lifting sessions a week. The week after, I do less so.

    My lifts are improving.

    Wish me luck!
    We will see how that goes.

  • 0:44 Me, who started breathing only through my nose in second grade because I was afraid kids would judge me for breathing too much through my mouth: relieved sigh

  • Dont eats nuts. At least you will fart all the day. It demonstrates that they are not for humans, all fiber issues, ballacks. I recomennd you only bone marrow. You need litlle of monounsat.. fat. Just a couple of spoon.

  • Increased my fat macro from 20% to 40% after researching about this and it totally is true. I have never felt better and more CHARGED than ever and I’m only 26. Been increasing peanut butter, pecans, olive oil and coconut oil have been my main way of increasing these 2 fats and will never look back!

  • Are you sure that your test levels weren’t low just because of what you were going through? Can’t imagine going through a divorce was helping you

  • There is all kinds of information on this stuff but I wish I could get a full plan of what to eat and supplements to take daily. Great video though.

  • My t levels are LOW(400 ng/dL ) and I feel like shit eating low calories and consuming supplements.im 19 years old and I have huge man boobs big gut but still have as much energy as a person with your body type and my junk is ��

  • at your age you should be dripping in testosteroneno need for a young dude to put a video out on TRT when its not even in your realm of experienceIf i was your age i could double my test by eating a pbj sandwichlol

  • I think my problem is eating to much sugar my whole family lives on sugar ima have to change there point of view and start eating some of these things

  • This was great, thanks, been searching for “best natural ways to boost testosterone” for a while now, and I think this has helped. Ever heard of Biyiley Sondalyn Review (Have a quick look on google cant remember the place now )? Ive heard some extraordinary things about it and my brother in law got excellent success with it.

  • I have proper tongue posture but sometimes my nose just doesn’t work and I need to breath through my mouth, and by sometimes I mean like every once a month but amazingly my teeth is straight… no jawline tho but maybe thats just because Im overweight:(

  • Thanks for this video. All the other videos on this topic are like: “boost your testosterone levels naturally by shoving these weeds up your ass and then drinking a gallon of coal infused bullshit”. This is the most informative one I could find.

  • Wheres the link to that study showing coconut oil and olive oil increase testosterone? Wheres the study showing elevated cholesterol levels are needed for optimal testosterone levels? Not referenced? Hmm. Bc they dont exist. Im not going to explain why its terrible health advice to eat excess oils or excess saturated fat, but theres lots of evidence linking those foods to a multitude of health problems. An ounce of nuts/seeds a day and 6-10 ounces of lean meats will meet everyone’s fat needs for optimal hormonal health. High carb whole plant foods are what is needed most for hormonal health. Promoting saturated fat as a health food is a fas right now.

  • If the rabbit antibody sticks to the mouse antibody then doesn’t that mean the mouse antibody sticks to the rabbit antibody? In that case it would be called rabbit-anti-anti-rabbit

  • Always great to watch your videos thanks!! Testosterone is much needed for man and especially natural ways to boost it! Check this good video for more direction too: https://www.youtube.com/watch?v=J8GpOyrKjkg

  • Great info! About how long does it take? I know it’s different for other people. But how long do you think you can start feeling a difference? I’m 39 and I’m at 307. If I buckle down and started applying all of your advice, how soon could I potentially be around 600? Thanks for the video!

  • Exercise is Good to our body me at mt age I exercise everyday to make me strong & healthy,I enjoy walkibg judging biking.thanks for sharing this video.

  • I’ve been keto for a couple weeks and haven’t drank beer in over a month, just started lifting again! My gf wouldn’t mind if we had sex more so I’m well on my way to increasing testosterone. Thanks!!

  • My T was a pathetic 370 three years ago, but after eliminating sugars and going low carb and IF, now 661 three years later. AARP not bad.

  • How’s about eat less sugar and bread. Increase protein and do leg workouts, All the time. Full body and or legs. 5 days a week with lots of stretching. Preferably in the morning. Take cold showers and get good sleep. You dick will wake you up in the morning. You will want to make a shield and spear and conquer your neighbors. Good luck my brothers.

  • Does win hof increases T level? I’ve been doing it for a week and it feels great honestly. And after taking cold showers it makes it much better. I feel good over all but I’m not really social and I feel guilty when I don’t socialize.

  • Cut down the amount of exercise, NOT EVERY DAY! the body is too stressed which will reduce testosterone. if your training hard in weights you don’t need cardio (why cardio!? ) if your into a particular sport,practice that, but other wise your heart cannot tell the difference.Save your energy for recovery and hard weight workouts. Control your body weight with eating better not exercise.

  • Great Tips! I’m gonna try some of these. I’ve also started getting more Zinc and Boron in my diet, I’m doing weights 4 days a week too. Defo noticing the difference, manboobs looking more like pecs now.

  • Clarification on the title: I of course don’t mean to suggest that attractiveness depends only on tongue posture. Nutrition of the mother and nutrition of the person during formative years surely play a very large role in how the face develops. In fact, the book Nutrition and Physical Degeneration would suggest that; fat soluble vitamins being very important for fertility and proper development of young, with grains & sugar (“modern foods”) being very detrimental for development and oral health especially. Oral posture would be another piece of the puzzle.
    On that note, Francis Pottenger’s experiment with cats found that cats on a poor diet developed deteriorated facial structure by the third generation.

    NOTE ON SUTURE FUSION: I wish I had used the phrasing “these sutures are not completely fused together,” or “sutures are not completely closed…” It’s understood that after birth, the sutures of the skull “fuse” together by age 2 or so. One study found that complete closure of certain sutures does not occur until as late as 70 years old. Another found that “The human frontozygomatic suture undergoes synostosis during the eigth decade of life, but does not completely fuse by the age of 95 years,” based on 61 human cadavers aged 20 to 95.
    -See the linked PDF in the description for more details/links

  • Okay, I have an issue with tongue placement, and it’s something that my dentist talks about with me. I push my tongue into my teeth in the front, instead of having it resting at the top. I’m gonna try this and come back in a year with results ��

  • Hi Justin, I’ve been binging these videos since I found them. I’m very interested in this line of work but am a physics junior already, with plans for a masters in electrical engineering, so my time to branch into biology while in undergrad is limited. Do you have any suggestions on classes to take that would set me up well to combine engineering, physics, coding, and bio? Or suggestions on extracurriculars or diy stepping stones?

    Thanks to you I’m looking into a magnet implant, depending on my future specialization, this could be super useful.

  • A lot of people in the comments are saying stuff like “oh I’m gonna try this and I’ll update you guys in a few years” soo… I think I’m gonna do that:DD I’ve been putting my tongue on my palate for a few days/weeks now, I too will update you all, maybe next year. See ya future me 😉

  • The body needs cholesterol to build testosterone if you eat a high carb diet fat cannot get burned or build off which is key for cholesterol

  • Im doing this for like a year now, my cheek become a little bit hollow and my jawline become more defined I’m 16 years old now,when I was 14 I’m obese and my cheek is fat.

  • I’m a twin and my sister has straight teeth but i don’t, they’re not as straight as hers. I swallow differently & i do catch myself with an unwanted face posture. I’m going to change my tongue and drinking method. Im 17 rn and I’ll try to come back to this comment a year or two later. Just remind me lol 8/15/20

  • Great video in regards to overall health, however any man in his 20s or 30s with a level at or below 300 is low from a condition that will require TRT. Sorry guys, there’s no other way to get your numbers where you want them to be.

  • i have something to ask idk if it will ever be answered, is that only for teeth issues or does it also used for helping people to breath better? (when chin is back and blocks a bit the breahing passage)

  • I actually started resting my tongue on the roof of my mouth since I was around 16 (8 years ago), for no reason, I just did. And by looking at photos from school, it’s true. My face looks so much better.

  • Apparently my oral posture is correct since my tongue has always been rested on the upper part of my mouth since I was young, I still don’t see “attractiveness” here –

  • Can consuming many foods high in saturated fat, increasing cholesterol, not increase the risk of atherosclerosis? That’s my main concern. Also, if losing belly fat is something that needs to be done, is it best to avoid cardio and just try to lose weight using big compound lifts?

  • This tongue posture seems to help move jaws forward, but what about those with jaws they want to retract to the ideal aesthetic position, will this tongue pressing on top of mouth aid in jaw being pulled back in this case? I used to have my jaw too far back, but ive lived my teenage and adult life with this tongue habbit (coincidentally. i had no oral posture knowledge), and now my jaw is too far forward. I am worried fellow viewers will try this tongue posture to retract jaw backwards but have the opposite outcome years later.

  • I was told to hold this jaw posture by a speech pathologist so that my voice would heal after an injury. I hold it 24/7, even taught myself how to sleep like that. Had no idea it would change my face shape. Who knew!

  • There’s a seemingly new little conspiracy theory making the rounds that the people at the Pasteur Institute are morons, because they are using the primer nCoV_IP2-12759Rv ( CTCCCTTTGTTGTGTTGT ), which occurs in human cells.
    And, from what I can see, that sequence actually does appear in the human reference genome 3 times ( http://www.ensembl.org/Homo_sapiens/Tools/Blast/Ticket?tl=FcK5EAZylNgRWTgR ) at locations 8:63648346-63648363, 13:43792593-43792609 and 12:108300576-108300592.

    I obviously trust the Pasteur Institute more than some silly facebook theorist, but I would like to understand what I am missing. Shouldn’t that primer sequence get a ‘hit’ on any human cell, then? The other primers seem to be more specific. So why use that primer?

    At 18:45 you mention that they also use primers that always give positive hits on human cells as a control. But the Pasteur Institute specifically label this primer as a test for the RdRp gene

  • My tongue does that without me trying, mostly because it’s long. Are there negative side-effects for prolonged, uh, tongue pressing on the roof of the mouth?

  • Interesting video! However, I noticed how words like “civilized” and “modern” are used a opposites to “Indigenous” when comparing their teeth and diets and that promotes the idea that Indigenous cultures and lifestyles are inherently inferior (which they are not). It just has to do with our choices of words but it can have a lot of impact.

  • My tongue has always rested at the top of my mouth, my top teeth are completely straight, but my bottom is jacked �� America EXPLAIN.

  • I have (had; it probably needs fixing up) a face shield for wood working called the Trend AirShield. It has a HEPA filter and fan, providing constant positive pressure of filtered air. The specific gadget is dramatically overpriced and cheaply made, but the idea is great. How well would that work against the virus?

  • waaiitttt this explains why my mom has perfect teeth and my teeth became all misaligned?? She grew up in a province in the philippines and ate a lot of what they grew in their garden. I am the first generation child living in the U.S. eating modern foods…. wow this is some interesting information.

    i also feel very much attacked because i LOVE soup and prefer soft foods (like a whole damn baby). dang i didn’t know diet affects my teeth alignment. i guess i gotta start chomping on more fibrous fruits, vegetables and raw meat.

  • Actually ” adapting a modern lifestyle” meant unhealthy foods from the colonizers forced on them due to poverty….which came from systemic genocide and cultural genocide

  • Hey! Im a 16 years old girl with a little double chin, many cheeks, like a fat face, besides I have an oval face. Im gonna raise my tongue every day and when I get results I tell you! Look foward to just like I am /@[email protected]/

  • My dentist confirmed that if the tongue pushes against the palate you can straiten your theeth. I did it for the past years and he said it changed my teeth. Keep doing it guys!

  • can you use a pippette on multiple samples without cleaning in between runs? asking mostly in reference for the cnc bio machine. more specifically can you get away with pippetting different reagents, and when would you clean pippettes

  • you guys gotta be kidding, right? HCG at 1000iu per week or Clomid 25mg every other day (this one should only be used short term, visual disturbances may occur) will increase endogen T levels at least doubling those values. Don’t take just my word, both medications are used off label by some doctors and even athletes.

  • I knew my orthodontist was fantastic, but I didn’t know to what degree. He had me resting my tongue on the roof of my mouth since I was 8 or 9. It completely changed the arch angle my teeth were at, and now my mouth is wide enough to hold all my teeth straight, like what is shown in this video. (My teeth are slightly larger than average as well.) I was so young, so I didn’t think to ask about the logic behind what he told me to do, so hearing this now at 22 is fascinating. I also can’t even imagine not keeping my tongue on the roof of my mouth… totally feels weird to not have it there. Great video!

  • Before a childs adult teeth grow they sit inside their palate on top their baby teeth. One theory that I have is that when a child sucks on a bottle the force exerted by the lips on the palate and by extension the teeth inside, makes the teeth grow crooked.

  • I started doing this when i lost my retainers and my teeth have stayed straight even though I was told if I didn’t wear them they would go back. its been a couple years and there still extremely straight even nicer than right after my braces

  • Just a reminder that the remodeling rate of bone, once you are an adult, is very very slow. Think like from 20s to late in life, that would be enough to have an effect. However, if you think tongue posturing will save your face now, it’s already too late. Should have had orthodontic intervention when your bones were still growing in childhood and teenage years. Now it’s only a trip to the Max-fac or a fixed orthodontic appliance for arch expansion or something similar.

  • I once read in Josh Kaufman’s book: The Personal MBA, ‘If you want to do good work, taking care of yourself is not optional’. Those words have stuck with me and make so much sense, your mind might want to take you places your body cannot go, and just as Elliot, and countless others before him have said, the mind and the body are part of the same and must be looked after appropriately.

  • There is no scientific evidence that increasing dietary cholesterol will boost testosterone, quite the opposite believe it or not. The reason this is cholesterol is needed to create the steroid hormones however this doesn’t mean cholesterol will increase testosterone, it will actually increase estrogen by a lot (estrogen is a steroid hormone). Our bodies already make the cholesterol we need

  • I start working out because i could not fight back when i was bullied now i train everyday i gain respect and people dont pick on me anymore

  • These 2 clowns are just farting and talking hot-air. Hulse is NOT WORTH quoting for any reason. He’s a self-styled YouTube blabber mouth and nothing else.

  • Elliot is a well known philosopher, PhD in so many areas of science and a top athlete and top notch coach of world champions. Now I find out he is an expert in yoga and shite wow

  • Talking about dance, there’s a tribe in South Africa call The San that used Dance as their main tool for achieving Altered States of Consciousness.